Go to The Journal of Clinical Investigation
  • About
  • Editors
  • Consulting Editors
  • For authors
  • Journal stats
  • Publication ethics
  • Publication alerts by email
  • Transfers
  • Advertising
  • Job board
  • Contact
  • Physician-Scientist Development
  • Current issue
  • Past issues
  • By specialty
    • COVID-19
    • Cardiology
    • Immunology
    • Metabolism
    • Nephrology
    • Oncology
    • Pulmonology
    • All ...
  • Videos
  • Collections
    • In-Press Preview
    • Resource and Technical Advances
    • Clinical Research and Public Health
    • Research Letters
    • Editorials
    • Perspectives
    • Physician-Scientist Development
    • Reviews
    • Top read articles

  • Current issue
  • Past issues
  • Specialties
  • In-Press Preview
  • Resource and Technical Advances
  • Clinical Research and Public Health
  • Research Letters
  • Editorials
  • Perspectives
  • Physician-Scientist Development
  • Reviews
  • Top read articles
  • About
  • Editors
  • Consulting Editors
  • For authors
  • Journal stats
  • Publication ethics
  • Publication alerts by email
  • Transfers
  • Advertising
  • Job board
  • Contact
Top
  • View PDF
  • Download citation information
  • Send a comment
  • Terms of use
  • Standard abbreviations
  • Need help? Email the journal
  • Top
  • Abstract
  • Introduction
  • Results
  • Discussion
  • Methods
  • Author contributions
  • Supplemental material
  • Acknowledgments
  • Footnotes
  • References
  • Version history
  • Article usage
  • Citations to this article
Advertisement

Research ArticleDevelopmentEndocrinology Open Access | 10.1172/jci.insight.189343

Neonatal diabetes–associated missense PDX1 variant disrupts chromatin association and protein-protein interaction

Xiaodun Yang,1 Angela Zanfardino,2 Riccardo Schiaffini,3 Jeff Ishibashi,1 Bareket Daniel,1 Matthew W. Haemmerle,1 Novella Rapini,3 Alessia Piscopo,2 Emanuele Miraglia del Giudice,4 Maria Cristina Digilio,5 Raffaele Iorio,6 Mafalda Mucciolo,7 Stefano Cianfarani,3,8,9 Dario Iafusco,2 Fabrizio Barbetti,10 and Doris A. Stoffers1

1Institute for Diabetes, Obesity and Metabolism, Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, USA.

2Regional Center for Pediatric Diabetes, Department of Pediatrics, University of Campania Luigi Vanvitelli, Naples, Italy.

3Diabetology and Growth Disorders Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

4Department of Pediatrics, University of Campania “Luigi Vanvitelli,” Caserta CE, Italy.

5Medical Genetics Unit and Medical Genetics and Rare Disease Research Division, Bambino Gesù Children Hospital, IRCCS, Rome, Italy.

6Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II, Naples, Italy.

7Translational Cytogenomics Research Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

8Department of Systems Medicine, University of Rome “Tor Vergata,” Rome, Italy.

9Department of Women’s and Children’s Health, Karolinska Institutet, Stockholm, Sweden.

10Clinical Laboratory Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

Authorship note: XY and AZ contributed equally to this work and are co–first authors.

Find articles by Yang, X. in: PubMed | Google Scholar

1Institute for Diabetes, Obesity and Metabolism, Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, USA.

2Regional Center for Pediatric Diabetes, Department of Pediatrics, University of Campania Luigi Vanvitelli, Naples, Italy.

3Diabetology and Growth Disorders Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

4Department of Pediatrics, University of Campania “Luigi Vanvitelli,” Caserta CE, Italy.

5Medical Genetics Unit and Medical Genetics and Rare Disease Research Division, Bambino Gesù Children Hospital, IRCCS, Rome, Italy.

6Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II, Naples, Italy.

7Translational Cytogenomics Research Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

8Department of Systems Medicine, University of Rome “Tor Vergata,” Rome, Italy.

9Department of Women’s and Children’s Health, Karolinska Institutet, Stockholm, Sweden.

10Clinical Laboratory Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

Authorship note: XY and AZ contributed equally to this work and are co–first authors.

Find articles by Zanfardino, A. in: PubMed | Google Scholar

1Institute for Diabetes, Obesity and Metabolism, Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, USA.

2Regional Center for Pediatric Diabetes, Department of Pediatrics, University of Campania Luigi Vanvitelli, Naples, Italy.

3Diabetology and Growth Disorders Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

4Department of Pediatrics, University of Campania “Luigi Vanvitelli,” Caserta CE, Italy.

5Medical Genetics Unit and Medical Genetics and Rare Disease Research Division, Bambino Gesù Children Hospital, IRCCS, Rome, Italy.

6Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II, Naples, Italy.

7Translational Cytogenomics Research Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

8Department of Systems Medicine, University of Rome “Tor Vergata,” Rome, Italy.

9Department of Women’s and Children’s Health, Karolinska Institutet, Stockholm, Sweden.

10Clinical Laboratory Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

Authorship note: XY and AZ contributed equally to this work and are co–first authors.

Find articles by Schiaffini, R. in: PubMed | Google Scholar

1Institute for Diabetes, Obesity and Metabolism, Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, USA.

2Regional Center for Pediatric Diabetes, Department of Pediatrics, University of Campania Luigi Vanvitelli, Naples, Italy.

3Diabetology and Growth Disorders Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

4Department of Pediatrics, University of Campania “Luigi Vanvitelli,” Caserta CE, Italy.

5Medical Genetics Unit and Medical Genetics and Rare Disease Research Division, Bambino Gesù Children Hospital, IRCCS, Rome, Italy.

6Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II, Naples, Italy.

7Translational Cytogenomics Research Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

8Department of Systems Medicine, University of Rome “Tor Vergata,” Rome, Italy.

9Department of Women’s and Children’s Health, Karolinska Institutet, Stockholm, Sweden.

10Clinical Laboratory Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

Authorship note: XY and AZ contributed equally to this work and are co–first authors.

Find articles by Ishibashi, J. in: PubMed | Google Scholar

1Institute for Diabetes, Obesity and Metabolism, Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, USA.

2Regional Center for Pediatric Diabetes, Department of Pediatrics, University of Campania Luigi Vanvitelli, Naples, Italy.

3Diabetology and Growth Disorders Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

4Department of Pediatrics, University of Campania “Luigi Vanvitelli,” Caserta CE, Italy.

5Medical Genetics Unit and Medical Genetics and Rare Disease Research Division, Bambino Gesù Children Hospital, IRCCS, Rome, Italy.

6Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II, Naples, Italy.

7Translational Cytogenomics Research Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

8Department of Systems Medicine, University of Rome “Tor Vergata,” Rome, Italy.

9Department of Women’s and Children’s Health, Karolinska Institutet, Stockholm, Sweden.

10Clinical Laboratory Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

Authorship note: XY and AZ contributed equally to this work and are co–first authors.

Find articles by Daniel, B. in: PubMed | Google Scholar

1Institute for Diabetes, Obesity and Metabolism, Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, USA.

2Regional Center for Pediatric Diabetes, Department of Pediatrics, University of Campania Luigi Vanvitelli, Naples, Italy.

3Diabetology and Growth Disorders Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

4Department of Pediatrics, University of Campania “Luigi Vanvitelli,” Caserta CE, Italy.

5Medical Genetics Unit and Medical Genetics and Rare Disease Research Division, Bambino Gesù Children Hospital, IRCCS, Rome, Italy.

6Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II, Naples, Italy.

7Translational Cytogenomics Research Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

8Department of Systems Medicine, University of Rome “Tor Vergata,” Rome, Italy.

9Department of Women’s and Children’s Health, Karolinska Institutet, Stockholm, Sweden.

10Clinical Laboratory Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

Authorship note: XY and AZ contributed equally to this work and are co–first authors.

Find articles by Haemmerle, M. in: PubMed | Google Scholar

1Institute for Diabetes, Obesity and Metabolism, Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, USA.

2Regional Center for Pediatric Diabetes, Department of Pediatrics, University of Campania Luigi Vanvitelli, Naples, Italy.

3Diabetology and Growth Disorders Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

4Department of Pediatrics, University of Campania “Luigi Vanvitelli,” Caserta CE, Italy.

5Medical Genetics Unit and Medical Genetics and Rare Disease Research Division, Bambino Gesù Children Hospital, IRCCS, Rome, Italy.

6Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II, Naples, Italy.

7Translational Cytogenomics Research Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

8Department of Systems Medicine, University of Rome “Tor Vergata,” Rome, Italy.

9Department of Women’s and Children’s Health, Karolinska Institutet, Stockholm, Sweden.

10Clinical Laboratory Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

Authorship note: XY and AZ contributed equally to this work and are co–first authors.

Find articles by Rapini, N. in: PubMed | Google Scholar

1Institute for Diabetes, Obesity and Metabolism, Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, USA.

2Regional Center for Pediatric Diabetes, Department of Pediatrics, University of Campania Luigi Vanvitelli, Naples, Italy.

3Diabetology and Growth Disorders Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

4Department of Pediatrics, University of Campania “Luigi Vanvitelli,” Caserta CE, Italy.

5Medical Genetics Unit and Medical Genetics and Rare Disease Research Division, Bambino Gesù Children Hospital, IRCCS, Rome, Italy.

6Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II, Naples, Italy.

7Translational Cytogenomics Research Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

8Department of Systems Medicine, University of Rome “Tor Vergata,” Rome, Italy.

9Department of Women’s and Children’s Health, Karolinska Institutet, Stockholm, Sweden.

10Clinical Laboratory Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

Authorship note: XY and AZ contributed equally to this work and are co–first authors.

Find articles by Piscopo, A. in: PubMed | Google Scholar

1Institute for Diabetes, Obesity and Metabolism, Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, USA.

2Regional Center for Pediatric Diabetes, Department of Pediatrics, University of Campania Luigi Vanvitelli, Naples, Italy.

3Diabetology and Growth Disorders Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

4Department of Pediatrics, University of Campania “Luigi Vanvitelli,” Caserta CE, Italy.

5Medical Genetics Unit and Medical Genetics and Rare Disease Research Division, Bambino Gesù Children Hospital, IRCCS, Rome, Italy.

6Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II, Naples, Italy.

7Translational Cytogenomics Research Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

8Department of Systems Medicine, University of Rome “Tor Vergata,” Rome, Italy.

9Department of Women’s and Children’s Health, Karolinska Institutet, Stockholm, Sweden.

10Clinical Laboratory Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

Authorship note: XY and AZ contributed equally to this work and are co–first authors.

Find articles by Miraglia del Giudice, E. in: PubMed | Google Scholar

1Institute for Diabetes, Obesity and Metabolism, Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, USA.

2Regional Center for Pediatric Diabetes, Department of Pediatrics, University of Campania Luigi Vanvitelli, Naples, Italy.

3Diabetology and Growth Disorders Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

4Department of Pediatrics, University of Campania “Luigi Vanvitelli,” Caserta CE, Italy.

5Medical Genetics Unit and Medical Genetics and Rare Disease Research Division, Bambino Gesù Children Hospital, IRCCS, Rome, Italy.

6Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II, Naples, Italy.

7Translational Cytogenomics Research Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

8Department of Systems Medicine, University of Rome “Tor Vergata,” Rome, Italy.

9Department of Women’s and Children’s Health, Karolinska Institutet, Stockholm, Sweden.

10Clinical Laboratory Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

Authorship note: XY and AZ contributed equally to this work and are co–first authors.

Find articles by Digilio, M. in: PubMed | Google Scholar

1Institute for Diabetes, Obesity and Metabolism, Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, USA.

2Regional Center for Pediatric Diabetes, Department of Pediatrics, University of Campania Luigi Vanvitelli, Naples, Italy.

3Diabetology and Growth Disorders Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

4Department of Pediatrics, University of Campania “Luigi Vanvitelli,” Caserta CE, Italy.

5Medical Genetics Unit and Medical Genetics and Rare Disease Research Division, Bambino Gesù Children Hospital, IRCCS, Rome, Italy.

6Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II, Naples, Italy.

7Translational Cytogenomics Research Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

8Department of Systems Medicine, University of Rome “Tor Vergata,” Rome, Italy.

9Department of Women’s and Children’s Health, Karolinska Institutet, Stockholm, Sweden.

10Clinical Laboratory Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

Authorship note: XY and AZ contributed equally to this work and are co–first authors.

Find articles by Iorio, R. in: PubMed | Google Scholar

1Institute for Diabetes, Obesity and Metabolism, Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, USA.

2Regional Center for Pediatric Diabetes, Department of Pediatrics, University of Campania Luigi Vanvitelli, Naples, Italy.

3Diabetology and Growth Disorders Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

4Department of Pediatrics, University of Campania “Luigi Vanvitelli,” Caserta CE, Italy.

5Medical Genetics Unit and Medical Genetics and Rare Disease Research Division, Bambino Gesù Children Hospital, IRCCS, Rome, Italy.

6Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II, Naples, Italy.

7Translational Cytogenomics Research Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

8Department of Systems Medicine, University of Rome “Tor Vergata,” Rome, Italy.

9Department of Women’s and Children’s Health, Karolinska Institutet, Stockholm, Sweden.

10Clinical Laboratory Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

Authorship note: XY and AZ contributed equally to this work and are co–first authors.

Find articles by Mucciolo, M. in: PubMed | Google Scholar

1Institute for Diabetes, Obesity and Metabolism, Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, USA.

2Regional Center for Pediatric Diabetes, Department of Pediatrics, University of Campania Luigi Vanvitelli, Naples, Italy.

3Diabetology and Growth Disorders Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

4Department of Pediatrics, University of Campania “Luigi Vanvitelli,” Caserta CE, Italy.

5Medical Genetics Unit and Medical Genetics and Rare Disease Research Division, Bambino Gesù Children Hospital, IRCCS, Rome, Italy.

6Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II, Naples, Italy.

7Translational Cytogenomics Research Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

8Department of Systems Medicine, University of Rome “Tor Vergata,” Rome, Italy.

9Department of Women’s and Children’s Health, Karolinska Institutet, Stockholm, Sweden.

10Clinical Laboratory Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

Authorship note: XY and AZ contributed equally to this work and are co–first authors.

Find articles by Cianfarani, S. in: PubMed | Google Scholar

1Institute for Diabetes, Obesity and Metabolism, Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, USA.

2Regional Center for Pediatric Diabetes, Department of Pediatrics, University of Campania Luigi Vanvitelli, Naples, Italy.

3Diabetology and Growth Disorders Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

4Department of Pediatrics, University of Campania “Luigi Vanvitelli,” Caserta CE, Italy.

5Medical Genetics Unit and Medical Genetics and Rare Disease Research Division, Bambino Gesù Children Hospital, IRCCS, Rome, Italy.

6Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II, Naples, Italy.

7Translational Cytogenomics Research Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

8Department of Systems Medicine, University of Rome “Tor Vergata,” Rome, Italy.

9Department of Women’s and Children’s Health, Karolinska Institutet, Stockholm, Sweden.

10Clinical Laboratory Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

Authorship note: XY and AZ contributed equally to this work and are co–first authors.

Find articles by Iafusco, D. in: PubMed | Google Scholar

1Institute for Diabetes, Obesity and Metabolism, Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, USA.

2Regional Center for Pediatric Diabetes, Department of Pediatrics, University of Campania Luigi Vanvitelli, Naples, Italy.

3Diabetology and Growth Disorders Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

4Department of Pediatrics, University of Campania “Luigi Vanvitelli,” Caserta CE, Italy.

5Medical Genetics Unit and Medical Genetics and Rare Disease Research Division, Bambino Gesù Children Hospital, IRCCS, Rome, Italy.

6Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II, Naples, Italy.

7Translational Cytogenomics Research Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

8Department of Systems Medicine, University of Rome “Tor Vergata,” Rome, Italy.

9Department of Women’s and Children’s Health, Karolinska Institutet, Stockholm, Sweden.

10Clinical Laboratory Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

Authorship note: XY and AZ contributed equally to this work and are co–first authors.

Find articles by Barbetti, F. in: PubMed | Google Scholar |

1Institute for Diabetes, Obesity and Metabolism, Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, USA.

2Regional Center for Pediatric Diabetes, Department of Pediatrics, University of Campania Luigi Vanvitelli, Naples, Italy.

3Diabetology and Growth Disorders Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

4Department of Pediatrics, University of Campania “Luigi Vanvitelli,” Caserta CE, Italy.

5Medical Genetics Unit and Medical Genetics and Rare Disease Research Division, Bambino Gesù Children Hospital, IRCCS, Rome, Italy.

6Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II, Naples, Italy.

7Translational Cytogenomics Research Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

8Department of Systems Medicine, University of Rome “Tor Vergata,” Rome, Italy.

9Department of Women’s and Children’s Health, Karolinska Institutet, Stockholm, Sweden.

10Clinical Laboratory Unit, Bambino Gesù Children’s Hospital, IRCCS, Rome, Italy.

Authorship note: XY and AZ contributed equally to this work and are co–first authors.

Find articles by Stoffers, D. in: PubMed | Google Scholar

Authorship note: XY and AZ contributed equally to this work and are co–first authors.

Published June 9, 2025 - More info

Published in Volume 10, Issue 11 on June 9, 2025
JCI Insight. 2025;10(11):e189343. https://doi.org/10.1172/jci.insight.189343.
© 2025 Yang et al. This work is licensed under the Creative Commons Attribution 4.0 International License. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
Published June 9, 2025 - Version history
Received: November 21, 2024; Accepted: April 17, 2025
View PDF
Abstract

PDX1 mutations are associated with multiple forms of diabetes, including syndromic, neonatal, mature onset diabetes of the young (MODY), and type 2 diabetes. Two PDX1 missense mutations (Thr151Met and Asn196Thr) were identified in a pediatric female patient that cause permanent neonatal diabetes, pancreas hypoplasia, and a malformed gallbladder. We found that the mouse Pdx1 Asn197Thr variant (homologous to human PDX1 Asn196Thr), but not Pdx1 Thr152Met (homologous to human PDX1 Thr151Met), altered its nuclear localization and disrupted the PDX1-ONECUT1 interaction. Neither variant substantially affected PDX1 protein stability, but both reduced PDX1 binding to the Pdx1 gene promoter. Importantly, the Pdx1 Asn197Thr variant caused pancreas agenesis and reduced enteroendocrine cells in the duodenum in genetically engineered mice, due at least in part to reduced Pdx1 promoter binding and disrupted PDX1-ONECUT1 interaction.

Introduction

Neonatal diabetes mellitus (NDM) is currently defined as persistent hyperglycemia with onset in the first 6 months of life (1). Remission of diabetes is observed in about 50%–60% of patients (transient NDM [TNDM]), while the permanent NDM (PNDM) is diagnosed in the remaining 40%–50%. In countries with a low consanguinity rate, heterozygous mutations of the KCNJ11, INS, and ABCC8 account for about 65% of patients with PNDM (1). In contrast, recessive genes are rarely involved. Here we describe an Italian patient with neonatal diabetes, severe exocrine pancreas insufficiency, and gallbladder malformation. The initial presentation of the patient was puzzling, with icterus, acholic stools, hypoalbuminemia, and anemia in addition to NDM. However, both hyperbilirubinemia and anemia resolved by the age of 4 months. Genetic analysis identified biallelic variants of PDX1 (or IPF1), a gene known to cause pancreas agenesis or PNDM (2–7).

The patient, the second child of nonconsanguineous parents (Figure 1A), presented with low birth weight (1,180 g; < third percentile) and length 40 cm (< third percentile) (8). On day 2 of life, plasma glucose was 482 mg/dL (26.7 mmol/L) and C-peptide undetectable (0.02 ng/mL) (Figure 1C). Abdominal ultrasound revealed a small and dysmorphic gallbladder with apparently normal liver and spleen; the pancreas could not be visualized. Further investigations showed a low fecal elastase (7 μg/g) (Figure 1C) and abnormal steatocrit (23%), both indicative of severe exocrine pancreas insufficiency. Nuclear magnetic resonance of the abdomen showed an enlarged liver and a small and dysmorphic gallbladder; head of the pancreas was visible, while body and tail could not be identified. I.v. insulin was initially administered along with ursodeoxycholic acid (UDCA), fat-soluble vitamins, total parenteral nutrition (TPN), and pancreatic enzymes. Detailed description of insulin therapy with sensor augmented pump initially and hybrid-closed loop device later has been reported elsewhere (8).

PDX1 N196T missense mutation identified in a pediatric patient with neonataFigure 1

PDX1 N196T missense mutation identified in a pediatric patient with neonatal diabetes impairs its localization, DNA binding, and protein-protein interaction. (A) Family history of the patient. (B) Human PDX1 protein structure. NLS, nuclear localization signal. (C) Clinical information of the patient. (D) PDX1 protein localization during interphase and mitotic phase in MIN6 cells. White arrow shows the N197T variant partially localized in the cytoplasm during interphase, while both PDX1 and T152M localized exclusively in nuclei. Scale bar: 5 µm. (E) Quantification of the percentage of cells with PDX1 localized in the cytoplasm (Pdx1, n = 30 cells; T152M, n = 26 cells; N197T, n = 24 cells). (F–H) Representative Western blot image showing protein levels after cycloheximide (CHX) treatment (F) in MIN6 cells, with quantification shown (G and H). For each vector, protein levels were first normalized to Ran and then to its level at 0 hours. One-way repeated-measures ANOVA, n = 4–7. (I) ChIP-qPCR showing Pdx1, T152M, and N197T variants binding on Pdx1, Nkx6.1, insulin 1, insulin 2, and albumin gene promoters in MIN6 cells. Student’s t test, n = 4–5. (J) Coimmunoprecipitation and Western blot showing N197T, but not T152M, disrupting PDX1-ONECUT1 (OC1) interaction in 293T cells (n = 3).

Results

Two PDX1 (NM_000209) variants were identified in the patient by a next-generation sequencing (NGS) gene panel (Supplemental Figure 1A; supplemental material available online with this article; https://doi.org/10.1172/jci.insight.189343DS1) and confirmed by Sanger sequencing: c.452C>T, p. Thr151Met (p. T151M, paternal; rs565726855) and c. 587A>C, p. Asn196Thr (p. N196T, maternal; rs771543377) (Figure 1, A and B). Both were present in gnomAD database (minor allele frequency: 0.000007131 and 0.00002790, respectively) and were classified as variants of uncertain significance (VUS) according to American College of Medical Genetics and Genomics (ACMG) rules. The patient’s father, carrying a normal PDX1 allele and the T151M variant, is nondiabetic. The patient’s mother, carrying a normal PDX1 allele and the N196T variant, only had gestational diabetes (Figure 1A). The patient, a compound heterozygote carrying both PDX1 variants, developed permanent NDM. The clinical and genetic data indicate that both T151M and N196T variants are disease-causing. Therefore, we performed functional analyses of these variants.

To examine how the mutations affect PDX1 functions, we expressed hemagglutinin-tagged (HA-tagged) mouse Pdx1 Thr152Met (T152M) and Asn197Thr (N197T), homologous to human PDX1 T151M and N196T, respectively (Supplemental Figure 1B), in mouse insulinoma MIN6 cells and examined protein localization, protein stability, and DNA binding. We found that the Pdx1 N197T variant, but not T152M, partially impaired its nuclear localization during interphase (Figure 1, D and E). Neither of the 2 variants substantially affected PDX1 protein stability (Figure 1, F–H). Both variants reduced PDX1 binding to the Pdx1 gene promoter (Figure 1I). Patients with ONECUT1 (OC1) mutations develop gallbladder agenesis/hypoplasia (9), which was also present in the pediatric patient in our study. To examine whether the mutations affect the interaction between PDX1 and OC1, we coexpressed HA-tagged mouse Pdx1 variants and Flag-tagged mouse Oc1 in human embryonic kidney 293T cells and found that Pdx1 N197T, but not T152M, disrupted the PDX1-OC1 interaction (Figure 1J).

Though both variants are disease causing and may impair pancreas development, we hypothesized that the N197T variant causes both pancreas hypoplasia and gallbladder malformation due to its altered nuclear localization, reduced chromatin association with Pdx1 promoter, and disruption in the PDX1-OC1 interaction. We therefore used CRISPR/Cas9 to generate E18 mouse embryos harboring the Pdx1 N197T variant to examine its roles in the development of the pancreas and other digestive organs in vivo. We collected 37 live E18 embryos with a range of genotypes that included WT alleles, the N197 variant and deletions around the protospacer adjacent motif (PAM) sequence (Table 1 and Supplemental Figure 2), and 1 dead embryo. Embryos with a WT allele plus the Pdx1 N197T variant or a deletion had normal pancreas development. Embryos carrying one Pdx1 N197T allele and an indel (inferred null) allele exhibited pancreas agenesis (Figure 2, A and B, and Supplemental Figure 2) and marked reductions in plasma insulin levels (Figure 2C), indicating that the Pdx1 N197T variant is insufficient for normal pancreas development. Notably, the in-frame deletion of 6 bases encoding amino acids 196 and 197, which occurred more frequently than other deletions, was also unable to support pancreas development (Figure 2, A and B, and Table 1), further underscoring the importance of residue 197 for normal pancreas development. There were comparable PDX1 protein levels in the proximal duodenum in samples carrying the Pdx1 N197T variant compared with those carrying WT alleles (Figure 2D), and nuclear localization was not noticeably impaired. The Pdx1 N197T variant also caused marked reductions in the number of enteroendocrine cells in the proximal duodenum (Figure 2E). The junction between the stomach and duodenum (Supplemental Figure 1C) and liver and gallbladder structure (Supplemental Figure 1D) appeared normal.

Mouse Pdx1 N197T causes pancreas agenesis and reduced generation of duodenaFigure 2

Mouse Pdx1 N197T causes pancreas agenesis and reduced generation of duodenal enteroendocrine cells in vivo. (A and B) Representative sample images and genotype information. The protein products of Pdx1del(6), Pdx1del(11), Pdx1del(22) are shown in the round brackets. Scale bar: 1 mm. (C) Plasma insulin levels (Normal: n = 6, Hypoplasia: n = 1, Agenesis: n = 21; Student’s t test). The dashed line indicates 0.05 ng/mL. (D) Comparable PDX1 protein localization and levels in the proximal duodenum samples with different genotypes. (E) Serotonin+ cells in duodenum (Student’s t test, n = 3). White arrows show the junction between stomach and duodenum. In the Pdx1+/– group, the genotypes of the 3 samples are Pdx1+/del(10), Pdx1+/del(6), and Pdx1+/del(6). In the Pdx1N197T/– group, the genotypes of the 3 samples are Pdx1N197T/del(11), Pdx1N197T/del(5), and Pdx1N197T/del(6) (Supplemental Figure 2). del, deletion. Scale bar: 20 µm (D), 200 µm (E).

Table 1

Summary of the 37 live E18 embryos collected.

Discussion

Previously, functional assessment has been carried out for 3 PDX1 missense mutations associated with PNDM. A patient with pancreas agenesis carrying the PDX1 variants p.Glu164Asp/Glu178Lys presented with low birth weight and high plasma glucose at DoL 12 (4). In this case, both mutations reduced PDX1 protein half-life, while nuclear translocation and DNA binding to target promoters were normal. By contrast, reduced transactivation was observed for homozygous PDX1 variant p.Glu178Gly detected in 2 patients with PNDM with a visible pancreas and subclinical insufficiency of exocrine pancreatic function (3). None of these patients had gallbladder malformation or liver impairment. Extrapancreatic phenotypes, including gallbladder hypoplasia/agenesis, in individuals carrying other PDX1 variants have also been reported (7).

The abnormal localization of Pdx1 N197T in the cytoplasm could contribute to its reduced chromatin association. We did not find noticeably altered nuclear localization of Pdx1 N197T in heterozygous embryos (Figure 2D), but it is possible that this variant affects PDX1 nuclear localization when expressed at high levels during pancreas development and at later stages. A substantial reduction in binding to the Pdx1 promoter of both Pdx1 variants and a trend toward reduced binding to the Nkx6.1 promoter of Pdx1 N197T (Figure 1I) is consistent with its roles in early pancreas development (10), which may be due to dysfunction of the PDX1 homeodomain (146–206 aa).

We reported a PDX1 missense mutation that dramatically impairs pancreas development, possibly due to a disrupted PDX1-OC1 interaction (Figure 1, I and J). We previously identified OC1 (formerly Hnf6) as a partner for PDX1 in the transcriptional activation of Neurog3 (11) and then demonstrated that OC1 and PDX1 cooperate in pancreatic progenitors to allow for proper differentiation and functional maturation of β cells (12). This interaction in pancreatic progenitors appeared to be required for postnatal islet adaptation to metabolic stress (12, 13). In addition to this role in the development of the endocrine pancreas, the pancreatic agenesis phenotype is consistent with critical early roles of the PDX1-OC1 interaction in pancreas development.

Whereas Pdx1 N197T reduced the generation of the enteroendocrine cells in the proximal duodenum (Figure 2E), it had no effect on the formation of the junction between the stomach and duodenum (Supplemental Figure 1C) compared with a Pdx1-null mouse model (14), indicating that the interaction with OC1 is dispensable for stomach patterning. Intriguingly, Pdx1 N197T also did not affect the structure of the gallbladder or liver, while the patient has a small and dysmorphic gallbladder. This implies that the well-established role of OC1 in hepatobiliary development is not dependent on interaction with PDX1. It also raises the possibility that human PDX1 T151M plays a greater role in the gallbladder phenotype of the patient or that the presence of both PDX1 N196T and T151M in the patient impairs the development of the gallbladder. The patient’s phenotypes, including pancreatic hypoplasia and gallbladder malformation, overlap with features seen in patients with RFX6 mutations (15). Moreover, PDX1 binds to RFX6 in human embryonic stem cell–derived pancreatic progenitors (16, 17), and RFX6 directs the development of endodermal organs partially by targeting PDX1 (18, 19). It is possible that the 2 PDX1 mutants may disrupt its binding to RFX6, causing impairments in the development of both pancreas and gallbladder (7).

We characterized a missense mutation that causes neonatal diabetes in humans and dramatically impaired pancreas development in mice, possibly due to reduced DNA binding and disrupted PDX1-OC1 interaction. The specific effects of this mutation on pancreas development and the generation of enteroendocrine cells in the duodenum highlight the distinct functions of different PDX1 protein domains during development.

Methods

Sex as a biologic variable. Sex was not considered as a biological variable. Both male and female mouse embryos were included.

Genetics. Genetic analysis of the patient’s genome performed by the kit Twist Custom Panel on a NovaSeq6000 as previously described (20). Variants identified were classified according to the ACMG (21).

Functional analysis of 2 PDX1 variants. Mouse Pdx1 variants T152M and N197T, homologous to human PDX1 variants Thr151Met and Asn196Thr (Supplemental Figure 1), were engineered into a pcDNA3 vector–expressing mouse Pdx1 with a 3 HA epitope tags (3). MIN6 cells transfected with these vectors were then utilized to assess Pdx1 WT and mutant protein localization by immunofluorescence (22). The following primary antibodies were used: mouse anti-HA (1:1,000, 26183, Invitrogen) and goat anti-PDX1 (1:2,500, gift from Chris Wright at Vanderbilt University, Nashville, Tennessee, USA; BCBC AB2027). The following secondary antibodies (1:1,000) were used: Alexa Fluor 488 donkey anti-goat (catalog 705-545-003) and Cy3 donkey anti-mouse (catalog 715-165-150) from Jackson ImmunoResearch. Protein stability was estimated by cycloheximide (CHX) chase assay (200 μg/mL, MilliporeSigma, C4859; ref. 23) and Western blot analysis. The following antibodies were used: mouse anti-HA (1:1,000, 26183, Invitrogen) and rabbit anti-Ran (1:10,000, 10469-1-AP, Proteintech). WT and mutant Pdx1 binding to insulin 1 and 2, Nkx6.1, Pdx1, and albumin (control) gene promoters was evaluated by ChIP-qPCR (24). Mouse anti-HA (26183, Invitrogen) was used. The following primer sets from (24) were used. Mouse insulin I: forward, TCAGCCAAAGATGAAGAAGGTCTC; reverse, TCCAAACACTTGCCTGGTGC. Pdx1: forward, TGGCTCGGGAAGGCTCTTG; reverse, CCATCAGGTGGCTAAATCCATTATG. Albumin: forward, TGGGAAAACTGGGAAAACCATC; reverse, CACTCTCACACATACACTCCTGCTG. The following primer sets from (25) were used. Mouse insulin II: forward, CCCCTGGACTTTGCTGTTT; reverse, GCCATCTGCTGACCTACCC. Nkx6.1: forward, CTGTTAGGTTTAGACACCACGC; Reverse, CCCTTCACCATCTTTCCGTCTCC. To examine how the mutations affect PDX1-OC1 interactions, we expressed HA-tagged mouse Pdx1 variants and Flag-tagged mouse Oc1 (gift from Scott Soleimanpour at the University of Michigan, Ann Arbor, Michigan, USA; MR207440) in human embryonic kidney 293T cells and performed co-IP/Western blot analysis to examine protein-protein interactions. The following antibodies were used: mouse anti-Flag (1:1,000, F1804, MilliporeSigma), rabbit anti-PDX1 (1:5,000, 5679, Cell Signaling Technology).

Mouse model generation and analysis. WT timed pregnant C57BL/6J females were ordered from the Jackson Laboratory, and embryos were collected at E18. We generated E18 C57BL/6J mouse embryos carrying the Pdx1 N197T missense mutation using CRISPR/Cas9 to examine its roles in the development of the pancreas and other digestive organs in vivo. Reagents of the Alt-R CRISPR-Cas9 System (Integrated DNA Technologies) were used. The guide RNA (crRNA) target sequence was 5′-TCCACTTCATGCGACGGTTT-3′. The Pdx1 N197T repair template sequence was 5′-AGGAATTCTTATTTAACAAATACATCTCCCGGCCCCGCCGGGTGGAGCTGGCAGTGATGTTGAACTTGACCGAGAGACACATCAAAATCTGGTTTCAAACCCGTCGCATGAAGTGGAAAAAAGAGGAAGATAAGAAACGTAGTAGCGGGACCCCGAGTGGGGGCGGTGGGGGCGAAGAGCCGGAGCAAGATTGTGCGGTG-3′. A WT repair template with a mutated Sp-Cas9 PAM site was coinjected for targeted WT repair that was immune to recutting by Cas9, using sequence 5′-AGGAATTCTTATTTAACAAATACATCTCCCGGCCCCGCCGGGTGGAGCTGGCAGTGATGTTGAACTTGACCGAGAGACACATCAAAATCTGGTTTCAAAACCGTCGCATGAAGTGGAAAAAAGAGGAAGATAAGAAACGTAGTAGCGGGACCCCGAGTGGGGGCGGTGGGGGCGAAGAGCCGGAGCAAGATTGTGCGGTG-3′. Embryos were genotyped using primers Forward (5′-CAGCTGCGATCAGTAGGAGG-3′) and Reverse (5′-GCTCTCGTGCCCTCAAGAAT-3′) to PCR-amplify products for Nanopore sequencing (Plasmidsaurus) and supervised alignment (Geneious Prime). Images of the embryonic organs were taken using an iPhone 11 via the eyepieces of a dissection microscope. A mouse insulin ELISA kit (90080, Crystal Chem) was used to measure plasma insulin. The following antibodies were used in immunofluorescence: primary antibodies, goat anti-serotonin (1:1,000, ab66047, Abcam), rabbit anti-CK19 (1:1,000, ab52625, Abcam), and goat anti-PDX1 (1:2,500, gift from Chris Wright at Vanderbilt University, BCBC AB2027) as well as secondary antibodies (Alexa Fluor 488 donkey anti-goat, 705-545-003; Cy3 donkey anti-rabbit, 711-165-152) from Jackson ImmunoResearch. Immunofluorescence images were take using a Zeiss LSM 880 Confocal microscope. Image analysis was performed using FIJI (26). H&E staining was performed by Lan Cheng at the Institute for Diabetes, Obesity and Metabolism Histology Core at the University of Pennsylvania.

Statistics. GraphPad Prism 10 was used. Data are shown as mean ± SEM. Two groups of data were compared using 2-tailed Student’s t test or 1-way repeated-measures ANOVA. P < 0.05 was considered significant. Statistical outliers identified using Grubbs’ test were excluded in the final analysis.

Study approval. Animal studies were approved by the University of Pennsylvania IACUC. Parents of the patient have provided written consent. The study complies with the Declaration of Helsinki.

Data availability. Data are available in the Supporting Data Values file.

Author contributions

XY, JI, FB, and DAS designed the experiments. XY, BD, and MWH performed the experiments. XY, JI, BD, and DAS analyzed data. XY and DAS prepared figures. AZ, RS, NR, AP, EMDG, MCD, RI, MM, SC, and DI collected patient data. XY, FB, and DAS wrote the manuscript. All authors participated in manuscript editing and approved the final version of the manuscript. The order of co–first authors was determined by relative contribution to this project.

Supplemental material

View Supplemental data

View Unedited blot and gel images

View Supporting data values

Acknowledgments

We would like to thank the Cell & Developmental Biology (CDB) Microscopy Core (RRID SCR_022373), the Comparative Pathology Core (RRID SCR_022438, supported by the Abramson Cancer Center Support Grant P30 CA016520), the Transgenic and Chimeric Mouse Facility, Gary D. Wu’s lab, Rebecca Wells’ lab, and Lan Cheng at the University of Pennsylvania; Scott Soleimanpour at the University of Michigan; and Chris Wright at Vanderbilt University for providing help and/or reagents. The current research was supported by NIH grants DK121175, DK122039, and DK135032 to DAS.

Address all correspondence to: Doris A. Stoffers, Institute for Diabetes, Obesity and Metabolism, Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, 19104, USA. Email: stoffers@pennmedicine.upenn.edu. Or to: Fabrizio Barbetti, Clinical Laboratory Unit, Bambino Gesù Children’s Hospital, IRCCS, Piazza S. Onofrio 4, Rome, Italy 00164. Email: fabrizio.barbetti@uniroma2.it.

Footnotes

Conflict of interest: DAS is coinventor on patent no. 6274310 (Compositions and methods for detecting pancreatic disease).

Copyright: © 2025, Yang et al. This is an open access article published under the terms of the Creative Commons Attribution 4.0 International License.

Reference information: JCI Insight. 2025;10(11):e189343.https://doi.org/10.1172/jci.insight.189343.

References
  1. Barbetti F, et al. The application of precision medicine in monogenic diabetes. Expert Rev Endocrinol Metab. 2022;17(2):111–129.
    View this article via: CrossRef PubMed Google Scholar
  2. Stoffers DA, et al. Pancreatic agenesis attributable to a single nucleotide deletion in the human IPF1 gene coding sequence. Nat Genet. 1997;15(1):106–110.
    View this article via: CrossRef PubMed Google Scholar
  3. Nicolino M, et al. A novel hypomorphic PDX1 mutation responsible for permanent neonatal diabetes with subclinical exocrine deficiency. Diabetes. 2010;59(3):733–740.
    View this article via: CrossRef PubMed Google Scholar
  4. Schwitzgebel VM, et al. Agenesis of human pancreas due to decreased half-life of insulin promoter factor 1. J Clin Endocrinol Metab. 2003;88(9):4398–4406.
    View this article via: CrossRef PubMed Google Scholar
  5. De Franco E, et al. Biallelic PDX1 (insulin promoter factor 1) mutations causing neonatal diabetes without exocrine pancreatic insufficiency. Diabet Med. 2013;30(5):e197–e200.
    View this article via: PubMed Google Scholar
  6. Krishnamurthy M, et al. Using human induced pluripotent stem cell–derived organoids to identify new pathologies in patients with PDX1 mutations. Gastroenterology. 2022;163(4):1053–1063.
    View this article via: CrossRef PubMed Google Scholar
  7. Jeffery N, et al. Widening the phenotypic spectrum caused by pathogenic PDX1 variants in individuals with neonatal diabetes. BMJ Open Diabetes Res Care. 2024;12(6):e004439.
    View this article via: CrossRef PubMed Google Scholar
  8. Zanfardino A, et al. Very low birth weight newborn with diabetes mellitus due to pancreas agenesis managed with insulin pump reservoir filled with undiluted insulin: 16-month follow-up. Diabetes Metab Syndr. 2022;16(7):102561.
    View this article via: CrossRef PubMed Google Scholar
  9. Philippi A, et al. Mutations and variants of ONECUT1 in diabetes. Nat Med. 2021;27(11):1928–1940.
    View this article via: CrossRef PubMed Google Scholar
  10. Pan FC, Wright C. Pancreas organogenesis: from bud to plexus to gland. Dev Dyn. 2011;240(3):530–565.
    View this article via: CrossRef PubMed Google Scholar
  11. Oliver-Krasinski JM, et al. The diabetes gene Pdx1 regulates the transcriptional network of pancreatic endocrine progenitor cells in mice. J Clin Invest. 2009;119(7):1888–1898.
    View this article via: JCI CrossRef PubMed Google Scholar
  12. Henley KD, et al. Threshold-dependent cooperativity of Pdx1 and Oc1 in pancreatic progenitors establishes competency for endocrine differentiation and β-Cell function. Cell Rep. 2016;15(12):2637–2650.
    View this article via: CrossRef PubMed Google Scholar
  13. Kropp PA, et al. Cooperative function of Pdx1 and Oc1 in multipotent pancreatic progenitors impacts postnatal islet maturation and adaptability. Am J Physiol Endocrinol Metab. 2018;314(4):E308–E321.
    View this article via: CrossRef PubMed Google Scholar
  14. Offield MF, et al. PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development. 1996;122(3):983–995.
    View this article via: CrossRef PubMed Google Scholar
  15. Spiegel R, et al. Clinical characterization of a newly described neonatal diabetes syndrome caused by RFX6 mutations. Am J Med Genet A. 2011;155A(11):2821–2825.
    View this article via: CrossRef PubMed Google Scholar
  16. Wang X, et al. Genome-wide analysis of PDX1 target genes in human pancreatic progenitors. Mol Metab. 2018;9:57–68.
    View this article via: CrossRef PubMed Google Scholar
  17. Yang X, et al. A PDX1 cistrome and single-cell transcriptome resource of the developing pancreas. Development. 2022;149(13):dev200432.
    View this article via: CrossRef PubMed Google Scholar
  18. Sanchez JG, et al. RFX6 regulates human intestinal patterning and function upstream of PDX1. Development. 2024;151(18):dev204379.
    View this article via: CrossRef PubMed Google Scholar
  19. Nakamura T, et al. Human RFX6 regulates endoderm patterning at the primitive gut tube stage. PNAS Nexus. 2024;3(1):pgae001.
    View this article via: CrossRef PubMed Google Scholar
  20. Rapini N, et al. Monogenic diabetes clinic (MDC): 3-year experience. Acta Diabetol. 2023;60(1):61–70.
    View this article via: CrossRef PubMed Google Scholar
  21. Richards S, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015;17(5):405–424.
    View this article via: CrossRef PubMed Google Scholar
  22. Yang X, et al. Coregulator Sin3a promotes postnatal murine β-Cell fitness by regulating genes in Ca2+ homeostasis, cell survival, vesicle biosynthesis, glucose metabolism, and stress response. Diabetes. 2020;69(6):1219–1231.
    View this article via: CrossRef PubMed Google Scholar
  23. Good AL, et al. JUND regulates pancreatic β cell survival during metabolic stress. Mol Metab. 2019;25:95–106.
    View this article via: CrossRef PubMed Google Scholar
  24. Chakrabarti SK, et al. Quantitative assessment of gene targeting in vitro and in vivo by the pancreatic transcription factor, Pdx1. Importance of chromatin structure in directing promoter binding. J Biol Chem. 2002;277(15):13286–13293.
    View this article via: CrossRef PubMed Google Scholar
  25. Spaeth JM, et al. The Pdx1-bound Swi/Snf chromatin remodeling complex regulates pancreatic progenitor cell proliferation and mature islet β-cell function. Diabetes. 2019;68(9):1806–1818.
    View this article via: CrossRef PubMed Google Scholar
  26. Schindelin J, et al. Fiji: an open-source platform for biological-image analysis. Nat Methods. 2012;9(7):676–682.
    View this article via: CrossRef PubMed Google Scholar
Version history
  • Version 1 (June 9, 2025): Electronic publication

Article tools

  • View PDF
  • Download citation information
  • Send a comment
  • Terms of use
  • Standard abbreviations
  • Need help? Email the journal

Metrics

  • Article usage
  • Citations to this article

Go to

  • Top
  • Abstract
  • Introduction
  • Results
  • Discussion
  • Methods
  • Author contributions
  • Supplemental material
  • Acknowledgments
  • Footnotes
  • References
  • Version history
Advertisement
Advertisement

Copyright © 2026 American Society for Clinical Investigation
ISSN 2379-3708

Sign up for email alerts